Core.Cast-Transform-Convert 3.2.0.80

An easy-to-use, portable, tested, documented, serializable, thread-safe, strongly typed library for changing between unrestricted, arbitrary data types

There is a newer version of this package available.
See the version list below for details.
Install-Package Core.Cast-Transform-Convert -Version 3.2.0.80
dotnet add package Core.Cast-Transform-Convert --version 3.2.0.80
<PackageReference Include="Core.Cast-Transform-Convert" Version="3.2.0.80" />
For projects that support PackageReference, copy this XML node into the project file to reference the package.
paket add Core.Cast-Transform-Convert --version 3.2.0.80
The NuGet Team does not provide support for this client. Please contact its maintainers for support.

Release Notes

=== Key Features ===

-Central thread-safe pool of converting functions
-Data Encapsulation
-Add converters at runtime or compile-time
-Consistent exception behavior
-Optional functions following the "Try" convention of .NET
-Instant improvement of source-code readability and maintainability
-Low overall performance impact
-Little to no learning curve
-Independent, portable library

______________________________________________________

### Getting started in 4 steps

1. *Install* with the <a href="http://goo.gl/iekUWH" target="_blank">NuGet Package manager</a>: `PM> Install-Package Core.TypeCast`.  
2. *Add the namespace* to your top-listed using directives: `using Core.TypeCast;`.
3. *Create a class* with one or more methods: `class MyConverter { ... int MyConverter(string argument) ... }`
4. *Attribute* any class with `[ConverterAttribute]`: _`public class MyConverter { ... }`_.    
   Subsequently, attribute the converting methods using `[ConverterMethodAttribute]`: _`public int MyConverter(string attribute){ ... }`__
5. **Done!**

Now, invoke conversions in your code anywhere as follows:
```cs
   var castedInt = "500s".CastTo<int>();
   var protein = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".ConvertTo<IProtein>();
```
Use library functions which suit the change of type descriptively:

   `var complimentary = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".Transform<Complementary>();`


_____________________________________________________

### Code Glance

Provided below is an abbreviated example of what code may look like in your project:

```cs
   using System.Runtime.CompilerServices;
   // IPolyNucleotide.cs
   public interface IPolyNucleotide { ... }

   // used for "Tranform-Aliasing"
   delegate DNA Complimentary(string dnaSequence, AModelClass arguments);

   // DNA.cs
   [Converter]
   public class DNA : IPolyNucleotide
   {
       [ConverterMethod]
       protected IProtein ToProtein(string dnaSequence, bool homologyLookup = false)
       {
           ... ...
       }

       [ConverterMethod]
       [MethodImpl(MethodImplOptions.AggressiveInlining)]
       public static DNA Complimentary(string dnaSequence, AModelClass arguments)
       {
           ... ...
       }
       ...
   }
```

NuGet packages

This package is not used by any NuGet packages.

GitHub repositories

This package is not used by any popular GitHub repositories.

Version History

Version Downloads Last updated
3.2.0.94 650 11/1/2016
3.2.0.93 430 11/1/2016
3.2.0.92 419 11/1/2016
3.2.0.91 421 11/1/2016
3.2.0.89 408 10/19/2016
3.2.0.86 436 10/17/2016
3.2.0.84 505 10/17/2016
3.2.0.82 458 10/17/2016
3.2.0.81 408 10/14/2016
3.2.0.80 413 10/14/2016
3.2.0.79 410 10/14/2016
3.2.0.78 462 10/13/2016
3.2.0.77 413 10/13/2016
3.2.0 424 10/13/2016
3.1.0.69 419 10/9/2016
3.1.0.5 572 10/9/2016
3.1.0.2 879 9/21/2016
3.1.0 437 10/3/2016
3.0.1.4 455 9/13/2016
3.0.1 411 10/3/2016
Show less